파이선 완전 왕초보


제가 지금 완전 모르는상태에서 파이선을 공부하고있는데 함수설정 def에 대해 질문하려합니다

 my_dna = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGC"        

    def get_at_content(dna):

     length = len(dna)

     a_count = dna.count('A')

     t_count = dna.count('T')

    at_content = (a_count + t_count) / length

    return at_content

여기서 어떻게 마무리를 해야 그다음으로 진행할수있나요 그냥 엔터치고 쭉 하면되나요 ??

  • 2018년 05월 15일에 수정됨
    루비와 파이썬을 좋아합니다. 새로운 언어를 배우는것도 좋아해요. 요즘은 개발은 주로 레일즈 사이트 수정하는 일을 하고, 예전에는 모바일 게임도 조금 만들어 봤습니다.
  • 2018년 05월 13일에 작성됨

  • 우선 파이썬 기초 서적부터 보시는 것을 추천드립니다. 다른 컴퓨터 랭귀지에 익숙하다면 1~2일정도만 튜터리얼을 보시면 됩니다. 만약 컴퓨터 랭귀지가 처음이라면 서점에 가시면 입문서들이 많습니다. 잘 읽히는 것으로 한권 선택하여 읽어보시길 권합니다.    정영훈   2018.5.14 01:25     
  • 그 다음으로 진행한다는게 무슨 말씀인지 잘 모르겠습니다.    김은기   2018.5.15 00:15     
  • 아.. print(get_at_content(my_dna)) 를 넣어보시기 바랍니다.    김은기   2018.5.15 00:16     
조회수 85


로그인이 필요한 기능입니다.

Hashcode는 개발자들을 위한 무료 QnA사이트 입니다. 작성한 답변에 다른 개발자들이 댓글을 작성하거나 좋아요/싫어요를 할 수 있기 때문에 계정을 필요로 합니다.
► 로그인
► 계정만들기
Close